Stem-loop sequence mmu-mir-216b

AccessionMI0004126 (change log)
Symbol MGI:Mir216b
DescriptionMus musculus miR-216b stem-loop
Gene family MIPF0000054; mir-216
Literature search

24 open access papers mention mmu-mir-216b
(81 sentences)

Stem-loop
   u  g        ga            c  a    --aug  ac 
5'  ug cagacugg  aaucucugcagg aa ugug     uc  u
    || ||||||||  |||||||||||| || ||||     ||   
3'  ac gucugacu  uuagagaugucc uu acac     ag  g
   a  a        uc            a  c    accaa  aa 
Get sequence
Deep sequencing
13038 reads, 63.3 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 28746191-28746276 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-216b
mmu-mir-216bchr11: 28746191-28746276 [+]
mmu-mir-216cchr11: 28746198-28746266 [-]
Database links

Mature sequence mmu-miR-216b-5p

Accession MIMAT0003729
Previous IDsmmu-miR-216b
Sequence

14 - 

aaaucucugcaggcaaauguga

 - 35

Get sequence
Deep sequencing12959 reads, 44 experiments
Evidence experimental; MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-216b-3p

Accession MIMAT0017233
Previous IDsmmu-miR-216b*
Sequence

54 - 

acacuuaccuguagagauucuu

 - 75

Get sequence
Deep sequencing60 reads, 10 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).