Stem-loop sequence mmu-mir-675

AccessionMI0004123 (change log)
Symbol MGI:Mir675
DescriptionMus musculus miR-675 stem-loop
Gene family MIPF0000365; mir-675
Literature search

38 open access papers mention mmu-mir-675
(276 sentences)

Stem-loop
   u  --              u    aa     cc      gac 
5'  gc  ggcccagggacugg gcgg  agggc  acagug   u
    ||  |||||||||||||| ||||  |||||  ||||||   u
3'  cg  cugggucccugacu cgcc  ucccg  ugucac   g
   a  gu              -    aa     ua      aug 
Get sequence
Deep sequencing
1995 reads, 12.5 reads per million, 40 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 142577064-142577147 [-]
sense
OTTMUST00000035613 ; H19-001; exon 1
OTTMUST00000035614 ; H19-002; intron 1
OTTMUST00000072694 ; H19-005; exon 2
ENSMUST00000149974 ; H19-002; intron 1
ENSMUST00000136359 ; H19-001; exon 1
ENSMUST00000152754 ; H19-005; exon 2
Database links

Mature sequence mmu-miR-675-5p

Accession MIMAT0003725
Sequence

15 - 

uggugcggaaagggcccacagu

 - 36

Get sequence
Deep sequencing601 reads, 32 experiments
Evidence experimental; MPSS [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-675-3p

Accession MIMAT0003726
Sequence

49 - 

cuguaugcccuaaccgcucagu

 - 70

Get sequence
Deep sequencing1392 reads, 29 experiments
Evidence experimental; MPSS [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).