Stem-loop sequence mmu-mir-301b

Accession

MI0004122

Symbol

MGI:Mir301b

Description

Mus musculus miR-301b stem-loop

Gene family

MIPF0000034; mir-130

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Stem-loop

u   -cu     c g        c    uagguugc    c  ug    g 
 uuc   gcugg u cgggugcu ugac        acua ug  cugu a
 |||   ||||| | |||||||| ||||        |||| ||  |||| g
 aag   cgacc g gucuacga acug        uggu ac  gacg a
g   cuc     a g        a    -----uua    a  gu    a 

Deep sequencing

198877 reads, 96 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCm38): chr16: 17124400-17124496 [-]
• Overlapping transcripts:

  sense

  ENSMUST00000093336 ; 2610318N02Rik-201; intron 1

Clustered miRNAs

< 10kb from mmu-mir-301b

• mmu-mir-301b: chr16: 17124400-17124496 [-]
• mmu-mir-130b: chr16: 17124061-17124142 [-]

Database links

• ENTREZGENE: 791069;Mir301b
• MGI: 3691602;Mir301b

Mature sequence mmu-miR-301b-5p

• Accession: MIMAT0017232
• Previous IDs: mmu-miR-301b*
• Sequence: 20 - gcucugacuagguugcacuacu - 41
• Deep sequencing: 175 reads, 31 experiments
• Evidence: experimental; Solexa [5]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-301b-5p
  • MIRDB:mmu-miR-301b-5p
  • RNA22-MMU:mmu-miR-301b-5p

Mature sequence mmu-miR-301b-3p

• Accession: MIMAT0004186
• Previous IDs: mmu-miR-301b
• Sequence: 55 - cagugcaaugguauugucaaagc - 77
• Deep sequencing: 90818 reads, 81 experiments
• Evidence: experimental; miRAP-cloned [1], cloned [2], 454 [3], Solexa [4-5]
• Validated targets:
  • TARBASE:mmu-miR-301b-3p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-301b-3p
  • MICRORNA.ORG:mmu-miR-301b-3p
  • MIRDB:mmu-miR-301b-3p
  • RNA22-MMU:mmu-miR-301b-3p
  • TARGETSCAN-VERT:mmu-miR-301b

References

1. PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).