Stem-loop sequence mmu-mir-1224

AccessionMI0004118 (change log)
Symbol MGI:Mir1224
DescriptionMus musculus miR-1224 stem-loop
Gene family MIPF0000440; mir-1224
Literature search

22 open access papers mention mmu-mir-1224
(54 sentences)

Stem-loop
   g      cu          ------    u   aucau      c 
5'  ugagga  ggggaggugg      aggg agc     uagagc a
    ||||||  ||||||||||      |||| |||     ||||||  
3'  acuccu  cuucuccacc      uccc ucg     gucucg g
   g      cu          ccccuc    -   acucu      a 
Get sequence
Deep sequencing
33867 reads, 109 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by more extensive cloning [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 20604452-20604536 [+]
sense
OTTMUST00000064280 ; Vwa5b2-005; intron 1
OTTMUST00000086876 ; Vwa5b2-004; intron 18
ENSMUST00000046188 ; Vwa5b2-005; intron 1
ENSMUST00000159780 ; Vwa5b2-004; intron 18
ENSMUST00000096197 ; Vwa5b2-201; intron 22
Database links

Mature sequence mmu-miR-1224-5p

Accession MIMAT0005460
Previous IDsmmu-miR-1224
Sequence

1 - 

gugaggacuggggagguggag

 - 21

Get sequence
Deep sequencing33804 reads, 58 experiments
Evidence experimental; RAKE [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-1224-3p

Accession MIMAT0017231
Previous IDsmmu-miR-1224*
Sequence

65 - 

ccccaccucuucucuccucag

 - 85

Get sequence
Deep sequencing49 reads, 16 experiments
Evidence experimental; Illumina [4]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).