Stem-loop sequence hsa-mir-764

Accession MI0003944
Description Homo sapiens miR-764 stem-loop
Gene family MIPF0000707; mir-764
Stem-loop 
    ua  ag    g   u    -  u        a   -  g 
aauc  gg  gcag ugc cacu ug ccuccucc ugc uu g
||||  ||  |||| ||| |||| || |||||||| ||| ||  
uuag  cc  uguc acg guga ac ggaggagg acg aa a
    ua  au    a   -    u  c        g   u  a
Get sequence
Comments

Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Artzi et al. later showed that it is a homolog of a validated miRNA in mouse [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 113873918-113874002 [+]
sense
OTTHUMT00000057961 ; HTR2C-001; intron 2
OTTHUMT00000057962 ; HTR2C-002; intron 2
OTTHUMT00000057963 ; HTR2C-003; intron 2
OTTHUMT00000057961 ; HTR2C-001; intron 2
OTTHUMT00000057962 ; HTR2C-002; intron 2
OTTHUMT00000057963 ; HTR2C-003; intron 2
OTTHUMT00000057961 ; HTR2C-001; intron 2
OTTHUMT00000057962 ; HTR2C-002; intron 2
OTTHUMT00000057963 ; HTR2C-003; intron 2
ENST00000371950 ; HTR2C-003; intron 2
ENST00000276198 ; HTR2C-002; intron 2
ENST00000371951 ; HTR2C-001; intron 2
ENST00000371951 ; HTR2C-001; intron 2
ENST00000276198 ; HTR2C-002; intron 2
ENST00000371950 ; HTR2C-003; intron 2
ENST00000371951 ; HTR2C-001; intron 2
ENST00000276198 ; HTR2C-002; intron 2
ENST00000371950 ; HTR2C-003; intron 2
Database links
  • ENTREZGENE: 100313838;MIR764

Mature sequence hsa-miR-764

Accession MIMAT0010367
Sequence

11 -  

gcaggugcucacuuguccuccu

 - 32

Get sequence
Evidence experimental; RAKE [1]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).