Stem-loop sequence hsa-mir-761

AccessionMI0003941 (change log)
Symbol HGNC:MIR761
DescriptionHomo sapiens miR-761 stem-loop
Gene family MIPF0000709; mir-761
Literature search

8 open access papers mention hsa-mir-761
(16 sentences)

Stem-loop
                         g  a  g 
5' ggaggagcagcagggugaaacu ac ca u
   |||||||||||||||||||||| || ||  
3' ccuccucgucguuucacuuuga ug gu u
                         g  -  c 
Get sequence
Deep sequencing
19 reads, 40 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Artzi et al. later showed that it is a homolog of a validated miRNA in mouse [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 51836344-51836402 [-]
sense
OTTHUMT00000022423 ; EPS15-002; intron 19
OTTHUMT00000022422 ; EPS15-001; intron 21
ENST00000396122 ; EPS15-201; intron 10
ENST00000371730 ; EPS15-002; intron 19
ENST00000371733 ; EPS15-001; intron 21
Database links

Mature sequence hsa-miR-761

Accession MIMAT0010364
Sequence

7 - 

gcagcagggugaaacugacaca

 - 28

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; RAKE [1]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).