Stem-loop sequence hsa-mir-761

Accession MI0003941
Description Homo sapiens miR-761 stem-loop
Gene family MIPF0000709; mir-761
Stem-loop 
                      g  a  g 
ggaggagcagcagggugaaacu ac ca u
|||||||||||||||||||||| || ||  
ccuccucgucguuucacuuuga ug gu u
                      g  -  c
Get sequence
Comments

Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Artzi et al. later showed that it is a homolog of a validated miRNA in mouse [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 52302016-52302074 [-]
sense
OTTHUMT00000022747 ; NRD1-001; intron 2
OTTHUMT00000023524 ; NRD1-004; intron 2
OTTHUMT00000023047 ; NRD1-013; intron 2
OTTHUMT00000022747 ; NRD1-001; intron 2
OTTHUMT00000023524 ; NRD1-004; intron 2
OTTHUMT00000023047 ; NRD1-013; intron 2
OTTHUMT00000022747 ; NRD1-001; intron 2
OTTHUMT00000023524 ; NRD1-004; intron 2
OTTHUMT00000023047 ; NRD1-013; intron 2
OTTHUMT00000023045 ; NRD1-002; intron 4
OTTHUMT00000023045 ; NRD1-002; intron 4
OTTHUMT00000023045 ; NRD1-002; intron 4
ENST00000390787 ; MIR761-201; exon 1
ENST00000390787 ; MIR761-201; exon 1
ENST00000390787 ; MIR761-201; exon 1
ENST00000352171 ; NRD1-001; intron 2
ENST00000485608 ; NRD1-004; intron 2
ENST00000475715 ; NRD1-013; intron 2
ENST00000371665 ; NRD1-201; intron 2
ENST00000546169 ; NRD1-204; intron 2
ENST00000544028 ; NRD1-203; intron 2
ENST00000352171 ; NRD1-001; intron 2
ENST00000485608 ; NRD1-004; intron 2
ENST00000475715 ; NRD1-013; intron 2
ENST00000371665 ; NRD1-201; intron 2
ENST00000546169 ; NRD1-204; intron 2
ENST00000544028 ; NRD1-203; intron 2
ENST00000352171 ; NRD1-001; intron 2
ENST00000485608 ; NRD1-004; intron 2
ENST00000475715 ; NRD1-013; intron 2
ENST00000544028 ; NRD1-202; intron 2
ENST00000354831 ; NRD1-002; intron 4
ENST00000539524 ; NRD1-202; intron 4
ENST00000354831 ; NRD1-002; intron 4
ENST00000539524 ; NRD1-202; intron 4
ENST00000354831 ; NRD1-002; intron 4
ENST00000539524 ; NRD1-201; intron 4
Database links
  • ENTREZGENE: 100313892;MIR761

Mature sequence hsa-miR-761

Accession MIMAT0010364
Sequence

7 -  

gcagcagggugaaacugacaca

 - 28

Get sequence
Evidence experimental; RAKE [1]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).