Stem-loop sequence hsa-mir-1298

Accession MI0003938
Symbol HGNC:MIR1298
Description Homo sapiens miR-1298 stem-loop
Gene family MIPF0000598; mir-1298
Stem-loop 
----agac       u         u    c             ------       ccc 
        gaggagu aagaguuca ucgg uguccagauguau      ccaagua   u
        ||||||| ||||||||| |||| |||||||||||||      |||||||    
        cuuuuca uuuucaagu aguc acgggucuacaua      gguuuau   g
acucagua       c         c    a             aauaac       ugu
Get sequence
Deep sequencing
2 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 113949650-113949761 [+]
sense
OTTHUMT00000057961 ; HTR2C-001; intron 2
OTTHUMT00000057962 ; HTR2C-002; intron 2
OTTHUMT00000057963 ; HTR2C-003; intron 2
OTTHUMT00000057961 ; HTR2C-001; intron 2
OTTHUMT00000057962 ; HTR2C-002; intron 2
OTTHUMT00000057963 ; HTR2C-003; intron 2
OTTHUMT00000057961 ; HTR2C-001; intron 2
OTTHUMT00000057962 ; HTR2C-002; intron 2
OTTHUMT00000057963 ; HTR2C-003; intron 2
ENST00000371950 ; HTR2C-003; intron 2
ENST00000276198 ; HTR2C-002; intron 2
ENST00000371951 ; HTR2C-001; intron 2
ENST00000371951 ; HTR2C-001; intron 2
ENST00000276198 ; HTR2C-002; intron 2
ENST00000371950 ; HTR2C-003; intron 2
ENST00000371951 ; HTR2C-001; intron 2
ENST00000276198 ; HTR2C-002; intron 2
ENST00000371950 ; HTR2C-003; intron 2
Database links

Mature sequence hsa-miR-1298

Accession MIMAT0005800
Sequence

18 -  

uucauucggcuguccagaugua

 - 39

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [2]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).