Stem-loop sequence hsa-mir-1298

AccessionMI0003938 (change log)
Symbol HGNC:MIR1298
DescriptionHomo sapiens miR-1298 stem-loop
Gene family MIPF0000598; mir-1298
Literature search

2 open access papers mention hsa-mir-1298
(2 sentences)

Stem-loop
   ----agac       u         u    c             ------       ccc 
5'         gaggagu aagaguuca ucgg uguccagauguau      ccaagua   u
           ||||||| ||||||||| |||| |||||||||||||      |||||||    
3'         cuuuuca uuuucaagu aguc acgggucuacaua      gguuuau   g
   acucagua       c         c    a             aauaac       ugu 
Get sequence
Deep sequencing
4648 reads, 2.78 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 114715233-114715344 [+]
intergenic
Database links

Mature sequence hsa-miR-1298-5p

Accession MIMAT0005800
Sequence

18 - 

uucauucggcuguccagaugua

 - 39

Get sequence
Deep sequencing4133 reads, 70 experiments
Evidence experimental; Illumina [2-3]
Predicted targets

Mature sequence hsa-miR-1298-3p

Accession MIMAT0026641
Sequence

72 - 

caucugggcaacugacugaac

 - 92

Get sequence
Deep sequencing487 reads, 34 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).