Stem-loop sequence hsa-mir-670

AccessionMI0003933
Symbol HGNC:MIR670
DescriptionHomo sapiens miR-670 stem-loop
Gene family MIPF0000734; mir-670
Stem-loop
     uu     ug ac      uc        u     - ug    ug au 
5' gu  agggg  g  cugaug  ccugagug augug g  aacc  a  u
   ||  |||||  |  ||||||  |||||||| ||||| |  ||||  |  u
3' ca  ucccc  u  gacugu  ggacuuac uauac c  uugg  u  g
     cu     gu --      ga        u     u cu    gu cc 
Get sequence
Deep sequencing
76 reads, 26.6 reads per million, 13 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Artzi et al. later showed that it is a homolog of a validated miRNA in mouse [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr11: 43559656-43559753 [+]
intergenic
Database links

Mature sequence hsa-miR-670-5p

Accession MIMAT0010357
Sequence

20 - 

gucccugaguguauguggug

 - 39

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; RAKE [1], Illumina [3]
Predicted targets

Mature sequence hsa-miR-670-3p

Accession MIMAT0026640
Sequence

59 - 

uuuccucauauucauucagga

 - 79

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [3]

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).