Stem-loop sequence hsa-mir-802

AccessionMI0003906 (change log)
Symbol HGNC:MIR802
DescriptionHomo sapiens miR-802 stem-loop
Gene family MIPF0000353; mir-802
Literature search

28 open access papers mention hsa-mir-802
(154 sentences)

Stem-loop
   ---guu      u     g c   a          a       -  cc 
5'       cuguua uugca u agu acaaagauuc uccuugu gu  a
         |||||| ||||| | ||| |||||||||| ||||||| ||  u
3'       gauaau aaugu a uca uguuucuaag aggaaca cg  c
   cagguc      u     g u   c          -       a  ua 
Get sequence
Deep sequencing
1628 reads, 267 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 35720715-35720808 [+]
sense
OTTHUMT00000471585 ; AP000320.7-001; intron 5
ENST00000362077 ; AP000320.7-001; intron 5
Database links

Mature sequence hsa-miR-802

Accession MIMAT0004185
Sequence

18 - 

caguaacaaagauucauccuugu

 - 40

Get sequence
Deep sequencing1618 reads, 6 experiments
Evidence experimental; miRAP-cloned [1]
Predicted targets

References

1
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).