Stem-loop sequence hsa-mir-762

AccessionMI0003892 (change log)
Symbol HGNC:MIR762
DescriptionHomo sapiens miR-762 stem-loop
Gene family MIPF0000624; mir-762
Literature search

25 open access papers mention hsa-mir-762
(95 sentences)

Stem-loop
        g   c    u        --  -a      g        
5' ggccc gcu cggg cucggccc  gu  cagucc gccggcc 
   ||||| ||| |||| ||||||||  ||  |||||| |||||| a
3' ccggg cgg gccc gagccggg  cg  gucggg cggucgu 
        g   c    -        gc  gg      g        
Get sequence
Deep sequencing
96 reads, 0 reads per million, 56 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Artzi et al. later showed that it is a homolog of a validated miRNA in mouse [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 30893903-30893985 [+]
sense
OTTHUMT00000433713 ; RP11-1072A3.2-002; intron 1
OTTHUMT00000433632 ; RP11-1072A3.2-001; intron 1
OTTHUMT00000433714 ; RP11-1072A3.2-003; intron 2
ENST00000570025 ; MIR4519-002; intron 1
ENST00000565573 ; MIR4519-001; intron 1
ENST00000564901 ; MIR4519-003; intron 2
antisense
OTTHUMT00000438646 ; AC106782.20-001; intron 1
OTTHUMT00000438643 ; BCL7C-005; intron 4
OTTHUMT00000255548 ; BCL7C-002; intron 5
OTTHUMT00000438645 ; BCL7C-004; intron 5
ENST00000572471 ; AC106782.20-001; intron 1
ENST00000574418 ; BCL7C-005; intron 4
ENST00000380317 ; BCL7C-002; intron 5
ENST00000572628 ; BCL7C-004; intron 5
Database links

Mature sequence hsa-miR-762

Accession MIMAT0010313
Sequence

49 - 

ggggcuggggccggggccgagc

 - 70

Get sequence
Deep sequencing37 reads, 26 experiments
Evidence experimental; RAKE [1]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).