Stem-loop sequence hsa-mir-378d-2

AccessionMI0003840 (change log)
Symbol HGNC:MIR378D2
DescriptionHomo sapiens miR-378d-2 stem-loop
Gene family MIPF0000168; mir-378
Literature search

194 open access papers mention hsa-mir-378d-2
(916 sentences)

Stem-loop
      ug   a  a    -    cacu           -ca   -a    uc 
5' gaa  guu ca ggag agaa    ggacuuggagu   gaa  acuu  a
   |||  ||| || |||| ||||    |||||||||||   |||  ||||   
3' uuu  uag gu ccuu ucuu    ccugaaucucg   cuu  ugaa  u
      gu   a  a    g    -uac           ucc   ac    cc 
Get sequence
Deep sequencing
5463373 reads, 4.79e+03 reads per million, 159 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 93916022-93916119 [-]
sense
OTTHUMT00000377521 ; TRIQK-002; intron 2
OTTHUMT00000377524 ; TRIQK-003; intron 2
OTTHUMT00000377657 ; TRIQK-012; intron 2
OTTHUMT00000377658 ; TRIQK-019; intron 2
OTTHUMT00000377659 ; TRIQK-015; intron 2
OTTHUMT00000377523 ; TRIQK-001; intron 3
OTTHUMT00000377653 ; TRIQK-005; intron 3
OTTHUMT00000377654 ; TRIQK-009; intron 3
OTTHUMT00000377522 ; TRIQK-004; intron 3
OTTHUMT00000377762 ; TRIQK-023; intron 3
OTTHUMT00000377763 ; TRIQK-020; intron 3
OTTHUMT00000377660 ; TRIQK-016; intron 3
OTTHUMT00000377661 ; TRIQK-018; intron 3
OTTHUMT00000377764 ; TRIQK-022; intron 3
OTTHUMT00000377655 ; TRIQK-007; intron 4
OTTHUMT00000377656 ; TRIQK-006; intron 4
OTTHUMT00000377662 ; TRIQK-017; intron 4
ENST00000523580 ; TRIQK-002; intron 2
ENST00000517540 ; TRIQK-003; intron 2
ENST00000521617 ; TRIQK-012; intron 2
ENST00000518400 ; TRIQK-019; intron 2
ENST00000520384 ; TRIQK-015; intron 2
ENST00000537541 ; TRIQK-201; intron 2
ENST00000521988 ; TRIQK-001; intron 3
ENST00000518748 ; TRIQK-005; intron 3
ENST00000520686 ; TRIQK-009; intron 3
ENST00000520430 ; TRIQK-004; intron 3
ENST00000524037 ; TRIQK-023; intron 3
ENST00000519069 ; TRIQK-020; intron 3
ENST00000524107 ; TRIQK-016; intron 3
ENST00000519969 ; TRIQK-018; intron 3
ENST00000522925 ; TRIQK-022; intron 3
ENST00000517858 ; TRIQK-007; intron 4
ENST00000378861 ; TRIQK-006; intron 4
ENST00000517751 ; TRIQK-017; intron 4
antisense
OTTHUMT00000377761 ; CTD-3239E11.2-002; intron 1
OTTHUMT00000377760 ; CTD-3239E11.2-001; intron 2
ENST00000521203 ; CTD-3239E11.2-002; intron 1
ENST00000523197 ; CTD-3239E11.2-001; intron 2
Database links

Mature sequence hsa-miR-378d

Accession MIMAT0018926
Sequence

22 - 

acuggacuuggagucagaaa

 - 41

Get sequence
Deep sequencing7496537 reads, 160 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).