Stem-loop sequence hsa-mir-320b-2

Accession MI0003839
Symbol HGNC:MIR320B2
Description Homo sapiens miR-320b-2 stem-loop
Gene family MIPF0000163; mir-320
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-320. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-320 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--uguuauuuuuugucuucuaccua        ------g  u   ag        uu     -a       a 
                         agaauucu       uc cuu  gcuuucuc  cccag  uuuccca a
                         ||||||||       || |||  ||||||||  |||||  |||||||  
                         ucuuaaga       ag gaa  cgggagag  ggguc  aaagggu g
aagggauagauuaauacagucucug        aaaaaaa  -   aa        uu     ga       u 
Get sequence
Deep sequencing
508037 reads, 50 experiments
Comments

This sequence was identified as a candidate by RAKE analysis [1], and later confirmed by Solexa sequencing [2,3]. The sequence was named mir-1242 in [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 224444706-224444843 [-]
sense
OTTHUMT00000091464 ; NVL-012; intron 1
OTTHUMT00000091464 ; NVL-012; intron 1
OTTHUMT00000091464 ; NVL-012; intron 1
OTTHUMT00000091465 ; NVL-013; intron 2
OTTHUMT00000091465 ; NVL-013; intron 2
OTTHUMT00000091465 ; NVL-013; intron 2
OTTHUMT00000357506 ; NVL-017; intron 16
OTTHUMT00000091455 ; NVL-003; intron 16
OTTHUMT00000357506 ; NVL-017; intron 16
OTTHUMT00000091455 ; NVL-003; intron 16
OTTHUMT00000357506 ; NVL-017; intron 16
OTTHUMT00000091455 ; NVL-003; intron 16
OTTHUMT00000357507 ; NVL-018; intron 17
OTTHUMT00000091454 ; NVL-002; intron 17
OTTHUMT00000357507 ; NVL-018; intron 17
OTTHUMT00000091454 ; NVL-002; intron 17
OTTHUMT00000357507 ; NVL-018; intron 17
OTTHUMT00000091454 ; NVL-002; intron 17
OTTHUMT00000091453 ; NVL-001; intron 18
OTTHUMT00000091453 ; NVL-001; intron 18
OTTHUMT00000091453 ; NVL-001; intron 18
ENST00000489194 ; NVL-012; intron 1
ENST00000489194 ; NVL-012; intron 1
ENST00000489194 ; NVL-012; intron 1
ENST00000496393 ; NVL-013; intron 2
ENST00000496393 ; NVL-013; intron 2
ENST00000496393 ; NVL-013; intron 2
ENST00000432338 ; PARP1-202; intron 5
ENST00000432338 ; PARP1-202; intron 5
ENST00000469968 ; NVL-003; intron 16
ENST00000482491 ; NVL-017; intron 16
ENST00000340871 ; NVL-201; intron 16
ENST00000361463 ; NVL-202; intron 16
ENST00000469968 ; NVL-003; intron 16
ENST00000482491 ; NVL-017; intron 16
ENST00000340871 ; NVL-201; intron 16
ENST00000361463 ; NVL-202; intron 16
ENST00000469968 ; NVL-003; intron 16
ENST00000482491 ; NVL-017; intron 16
ENST00000340871 ; NVL-201; intron 16
ENST00000361463 ; NVL-202; intron 16
ENST00000391875 ; NVL-002; intron 17
ENST00000469075 ; NVL-018; intron 17
ENST00000391875 ; NVL-002; intron 17
ENST00000469075 ; NVL-018; intron 17
ENST00000391875 ; NVL-002; intron 17
ENST00000469075 ; NVL-018; intron 17
ENST00000281701 ; NVL-001; intron 18
ENST00000281701 ; NVL-001; intron 18
ENST00000281701 ; NVL-001; intron 18
Database links

Mature sequence hsa-miR-320b

Accession MIMAT0005792
Sequence

72 - 

aaaagcuggguugagagggcaa

 - 93

Get sequence
Deep sequencing 508013 reads, 49 experiments
Evidence experimental; RAKE [1], Solexa [2-3]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
3
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).