Stem-loop sequence hsa-mir-320b-2

AccessionMI0003839 (change log)
Symbol HGNC:MIR320B2
DescriptionHomo sapiens miR-320b-2 stem-loop
Gene family MIPF0000163; mir-320
Literature search

146 open access papers mention hsa-mir-320b-2
(527 sentences)

Stem-loop
   ---g  u   ag        uu     -a       a 
5'     uc cuu  gcuuucuc  cccag  uuuccca a
       || |||  ||||||||  |||||  |||||||  
3'     ag gaa  cgggagag  ggguc  aaagggu g
   aaaa  -   aa        uu     ga       u 
Get sequence
Deep sequencing
1603475 reads, 5.25e+03 reads per million, 155 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a candidate by RAKE analysis [1], and later confirmed by Solexa sequencing [2,3]. The sequence was named mir-1242 in [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 224257040-224257110 [-]
intergenic
Database links

Mature sequence hsa-miR-320b

Accession MIMAT0005792
Sequence

41 - 

aaaagcuggguugagagggcaa

 - 62

Get sequence
Deep sequencing3244238 reads, 159 experiments
Evidence experimental; RAKE [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
3
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).