|
miRBase |
|
Stem-loop sequence hsa-mir-1283-1 |
|||||
| Accession | MI0003832 | ||||
| Symbol | HGNC:MIR1283-1 | ||||
| Description | Homo sapiens miR-1283-1 stem-loop | ||||
| Gene family | MIPF0000020; mir-515 | ||||
| Stem-loop |
-- ua g ac a g g c cucaagc uga ucu aaagg aagcgcuuucu uu u a ||||||| ||| ||| ||||| ||||||||||| || | g gaguuug auu gga uuucc uucgcgaaaga aa a a aa gc g gu c g g a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-1283 |
|
| Accession | MIMAT0005799 |
| Sequence |
14 - ucuacaaaggaaagcgcuuucu - 35 |
| Deep sequencing | 42 reads, 8 experiments |
| Evidence | experimental; Solexa [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
| 2 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|