Stem-loop sequence hsa-mir-449c

Accession MI0003823
Description Homo sapiens miR-449c stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   --g       u   gu   c      uu               u 
gcu   ggaugug cag  agg agugua  gcuagcggcuguuaa g
|||   ||||||| |||  ||| ||||||  ||||||||||||||| a
cga   cuuacgu guc  ucc ucacgu  ugaucguugacaauu u
   aga       u   uc   -      --               u 
Get sequence
Deep sequencing
3 reads, 3 experiments
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using the RAKE techniques [1]. Expression was later confirmed by Wyman et al. [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 54468090-54468181 [-]
sense
OTTHUMT00000369716 ; CDC20B-005; intron 1
OTTHUMT00000369716 ; CDC20B-005; intron 1
OTTHUMT00000369716 ; CDC20B-005; intron 1
OTTHUMT00000253908 ; CDC20B-001; intron 2
OTTHUMT00000369715 ; CDC20B-004; intron 2
OTTHUMT00000369714 ; CDC20B-003; intron 2
OTTHUMT00000369713 ; CDC20B-002; intron 2
OTTHUMT00000253908 ; CDC20B-001; intron 2
OTTHUMT00000369715 ; CDC20B-004; intron 2
OTTHUMT00000369714 ; CDC20B-003; intron 2
OTTHUMT00000369713 ; CDC20B-002; intron 2
OTTHUMT00000253908 ; CDC20B-001; intron 2
OTTHUMT00000369715 ; CDC20B-004; intron 2
OTTHUMT00000369714 ; CDC20B-003; intron 2
OTTHUMT00000369713 ; CDC20B-002; intron 2
ENST00000507931 ; CDC20B-005; intron 1
ENST00000331730 ; CDC20B-201; intron 1
ENST00000507931 ; CDC20B-005; intron 1
ENST00000331730 ; CDC20B-201; intron 1
ENST00000507931 ; CDC20B-005; intron 1
ENST00000331730 ; CDC20B-201; intron 1
ENST00000296733 ; CDC20B-001; intron 2
ENST00000381375 ; CDC20B-004; intron 2
ENST00000322374 ; CDC20B-003; intron 2
ENST00000513180 ; CDC20B-002; intron 2
ENST00000334206 ; CDC20B-202; intron 2
ENST00000296733 ; CDC20B-001; intron 2
ENST00000381375 ; CDC20B-004; intron 2
ENST00000322374 ; CDC20B-003; intron 2
ENST00000513180 ; CDC20B-002; intron 2
ENST00000334206 ; CDC20B-202; intron 2
ENST00000296733 ; CDC20B-001; intron 2
ENST00000381375 ; CDC20B-004; intron 2
ENST00000322374 ; CDC20B-003; intron 2
ENST00000513180 ; CDC20B-002; intron 2
ENST00000334206 ; CDC20B-202; intron 2
Clustered miRNAs
< 10kb from hsa-mir-449c
hsa-mir-449c chr5: 54468090-54468181 [-]
hsa-mir-449b chr5: 54466474-54466570 [-]
hsa-mir-449a chr5: 54466360-54466450 [-]
Database links

Mature sequence hsa-miR-449c-5p

Accession MIMAT0010251
Previous IDs hsa-miR-449c
Sequence

17 - 

uaggcaguguauugcuagcggcugu

 - 41

Get sequence
Deep sequencing 2 reads, 2 experiments
Evidence experimental; RAKE [1], 454 [2]
Predicted targets

Mature sequence hsa-miR-449c-3p

Accession MIMAT0013771
Previous IDs hsa-miR-449c*
Sequence

57 - 

uugcuaguugcacuccucucugu

 - 79

Get sequence
Evidence experimental; 454 [2]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:19390579 "Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries" Wyman SK, Parkin RK, Mitchell PS, Fritz BR, O'Briant K, Godwin AK, Urban N, Drescher CW, Knudsen BS, Tewari M PLoS One. 4:e5311(2009).