Stem-loop sequence hsa-mir-454

AccessionMI0003820
Symbol HGNC:MIR454
DescriptionHomo sapiens miR-454 stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
   u       ----  --a     uc            ---         ----   --u     g 
5'  cuguuua    uc   ccaga  cuagaacccuau   caauauugu    cuc   gcugu u
    |||||||    ||   |||||  ||||||||||||   |||||||||    |||   |||||  
3'  gacgggu    ag   gguuu  gguuuugggaua   guuauaacg    gag   ugaua a
   g       aaca  aaa     gu            uuc         ugau   ucu     a 
Get sequence
Deep sequencing
2325 reads, 377 reads per million, 63 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature miRNA sequences were named miR-454-5p and miR-454-3p in [1] and here. Landgraf et al. showed that the 3' product is the predominant one [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr17: 59137758-59137872 [-]
sense
OTTHUMT00000449605 ; RP11-264B14.1-001; intron 1
ENST00000588604 ; RP11-264B14.1-001; intron 1
antisense
OTTHUMT00000449592 ; BCAS3-028; intron 4
OTTHUMT00000449593 ; BCAS3-029; intron 4
OTTHUMT00000449586 ; BCAS3-006; intron 11
OTTHUMT00000449585 ; BCAS3-005; intron 12
OTTHUMT00000449582 ; BCAS3-013; intron 18
OTTHUMT00000449571 ; BCAS3-004; intron 19
OTTHUMT00000449575 ; BCAS3-002; intron 19
OTTHUMT00000449581 ; BCAS3-012; intron 19
OTTHUMT00000449578 ; BCAS3-001; intron 20
ENST00000585979 ; BCAS3-028; intron 4
ENST00000592827 ; BCAS3-029; intron 4
ENST00000588874 ; BCAS3-006; intron 11
ENST00000585744 ; BCAS3-005; intron 12
ENST00000408905 ; BCAS3-013; intron 18
ENST00000589222 ; BCAS3-004; intron 19
ENST00000407086 ; BCAS3-002; intron 19
ENST00000588462 ; BCAS3-012; intron 19
ENST00000390652 ; BCAS3-001; intron 20
Database links

Mature sequence hsa-miR-454-5p

Accession MIMAT0003884
Previous IDshsa-miR-454-5p;hsa-miR-454*
Sequence

24 - 

acccuaucaauauugucucugc

 - 45

Get sequence
Deep sequencing65 reads, 14 experiments
Evidence experimental; cloned [1-2]
Predicted targets

Mature sequence hsa-miR-454-3p

Accession MIMAT0003885
Previous IDshsa-miR-454-3p;hsa-miR-454
Sequence

64 - 

uagugcaauauugcuuauagggu

 - 86

Get sequence
Deep sequencing924 reads, 49 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).