Stem-loop sequence hsa-mir-454

Accession

MI0003820

Symbol

HGNC:MIR454

Description

Homo sapiens miR-454 stem-loop

Gene family

MIPF0000174; mir-454

Stem-loop

u       ----  --a     uc            ---         ----   --u     g 
 cuguuua    uc   ccaga  cuagaacccuau   caauauugu    cuc   gcugu u
 |||||||    ||   |||||  ||||||||||||   |||||||||    |||   |||||  
 gacgggu    ag   gguuu  gguuuugggaua   guuauaacg    gag   ugaua a
g       aaca  aaa     gu            uuc         ugau   ucu     a 

Deep sequencing

377 reads, 32 experiments

Comments

The mature miRNA sequences were named miR-454-5p and miR-454-3p in [1] and here. Landgraf et al. showed that the 3' product is the predominant one [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh37.p5): chr17: 57215119-57215233 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000445939 ; SKA2-001; intron 1

  OTTHUMT00000445940 ; SKA2-003; intron 1

  OTTHUMT00000445941 ; SKA2-009; intron 1

  OTTHUMT00000445942 ; SKA2-005; intron 1

  OTTHUMT00000445943 ; SKA2-007; intron 1

  OTTHUMT00000445944 ; SKA2-008; intron 1

  OTTHUMT00000445945 ; SKA2-002; intron 1

  OTTHUMT00000445946 ; SKA2-006; intron 1

  OTTHUMT00000445947 ; SKA2-004; intron 1

  OTTHUMT00000445948 ; SKA2-010; intron 1

  ENST00000330137 ; SKA2-201; intron 1

  ENST00000437036 ; SKA2-202; intron 1

  ENST00000330137 ; SKA2-201; intron 1

  ENST00000437036 ; SKA2-202; intron 1

  ENST00000330137 ; SKA2-001; intron 1

  ENST00000580541 ; SKA2-003; intron 1

  ENST00000578105 ; SKA2-009; intron 1

  ENST00000578519 ; SKA2-005; intron 1

  ENST00000583927 ; SKA2-007; intron 1

  ENST00000581068 ; SKA2-008; intron 1

  ENST00000437036 ; SKA2-002; intron 1

  ENST00000583380 ; SKA2-006; intron 1

  ENST00000583976 ; SKA2-004; intron 1

  ENST00000584089 ; SKA2-010; intron 1

Database links

• ENTREZGENE: 768216;MIR454
• HGNC: 33137;MIR454

Mature sequence hsa-miR-454-5p

• Accession: MIMAT0003884
• Previous IDs: hsa-miR-454-5p;hsa-miR-454*
• Sequence: 24 - acccuaucaauauugucucugc - 45
• Deep sequencing: 15 reads, 8 experiments
• Evidence: experimental; cloned [1-2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-454-5p
  • MICRORNA.ORG:hsa-miR-454-5p
  • MIRDB:hsa-miR-454-5p
  • RNA22-HSA:hsa-miR-454-5p
  • TARGETMINER:hsa-miR-454-5p

Mature sequence hsa-miR-454-3p

• Accession: MIMAT0003885
• Previous IDs: hsa-miR-454-3p;hsa-miR-454
• Sequence: 64 - uagugcaauauugcuuauagggu - 86
• Deep sequencing: 357 reads, 28 experiments
• Evidence: experimental; cloned [1-2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-454-3p
  • MICRORNA.ORG:hsa-miR-454-3p
  • MIRDB:hsa-miR-454-3p
  • RNA22-HSA:hsa-miR-454-3p
  • TARGETMINER:hsa-miR-454-3p
  • TARGETSCAN-VERT:hsa-miR-454

References

1. PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).