Stem-loop sequence hsa-mir-1271

AccessionMI0003814 (change log)
Symbol HGNC:MIR1271
DescriptionHomo sapiens miR-1271 stem-loop
Gene family MIPF0000483; mir-1271
Literature search

19 open access papers mention hsa-mir-1271
(34 sentences)

Stem-loop
   -ca  -   au             c     a           a 
5'    cc cag  cagugcuuggcac uagca gcacucaguaa u
      || |||  ||||||||||||| ||||| |||||||||||  
3'    gg guc  guuacggaccgug aucgu cgugaguuguu a
   ucg  a   gu             u     c           u 
Get sequence
Deep sequencing
25638 reads, 36.8 reads per million, 152 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 176367946-176368031 [+]
antisense
OTTHUMT00000372181 ; UIMC1-010; intron 5
OTTHUMT00000372176 ; UIMC1-005; intron 8
OTTHUMT00000253422 ; UIMC1-001; intron 10
OTTHUMT00000372177 ; UIMC1-006; intron 10
OTTHUMT00000372175 ; UIMC1-004; intron 10
OTTHUMT00000372174 ; UIMC1-003; intron 10
ENST00000503273 ; UIMC1-010; intron 5
ENST00000510698 ; UIMC1-005; intron 8
ENST00000377227 ; UIMC1-001; intron 10
ENST00000506128 ; UIMC1-006; intron 10
ENST00000511320 ; UIMC1-004; intron 10
ENST00000512031 ; UIMC1-003; intron 10
ENST00000377219 ; UIMC1-201; intron 10
Database links

Mature sequence hsa-miR-1271-5p

Accession MIMAT0005796
Previous IDshsa-miR-1271
Sequence

15 - 

cuuggcaccuagcaagcacuca

 - 36

Get sequence
Deep sequencing15617 reads, 150 experiments
Evidence experimental; Illumina [2], 454 [3]
Database links
Predicted targets

Mature sequence hsa-miR-1271-3p

Accession MIMAT0022712
Sequence

51 - 

agugccugcuaugugccaggca

 - 72

Get sequence
Deep sequencing9988 reads, 116 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
3
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).