|
miRBase |
|
Stem-loop sequence hsa-mir-1323 |
|||||
| Accession | MI0003786 | ||||
| Symbol | HGNC:MIR1323 | ||||
| Description | Homo sapiens miR-1323 stem-loop | ||||
| Gene family | MIPF0000617; mir-1323 | ||||
| Stem-loop |
ac g a g gugg uga guccucaaaacug gg gcauuuucu u ||| ||||||||||||| || ||||||||| u acu uagggguuuugac cc cgugaaagg u -a g - a aaag |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by cloning [2]. Afanasyeva et al. refer to this sequence using the internal identifier MYCNAMP_NB2_61 [2]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-1323 |
|
| Accession | MIMAT0005795 |
| Sequence |
11 - ucaaaacugaggggcauuuucu - 32 |
| Deep sequencing | 207 reads, 6 experiments |
| Evidence | experimental; RAKE [1], cloned [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
| 2 |
PMID:18230126
"New miRNAs cloned from neuroblastoma"
BMC Genomics. 9:52(2008).
|