Stem-loop sequence hsa-mir-1296

AccessionMI0003780 (change log)
Symbol HGNC:MIR1296
DescriptionHomo sapiens miR-1296 stem-loop
Gene family MIPF0000649; mir-1296
Literature search

13 open access papers mention hsa-mir-1296
(258 sentences)

Stem-loop
   ---a       aacu         c cu        cu   u     a 
5'     ccuaccu    ggguuaggg c  ggcuccau  ccu uagga a
       |||||||    ||||||||| |  ||||||||  ||| ||||| a
3'     gggugga    cccaauccc g  ucggggug  ggg gucuu c
   uguc       ----         a cu        ag   u     c 
Get sequence
Deep sequencing
31209 reads, 27.2 reads per million, 151 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 63372957-63373048 [-]
intergenic
Database links

Mature sequence hsa-miR-1296-5p

Accession MIMAT0005794
Sequence

16 - 

uuagggcccuggcuccaucucc

 - 37

Get sequence
Deep sequencing30289 reads, 148 experiments
Evidence experimental; Illumina [2,4], 454 [3]
Database links
Predicted targets

Mature sequence hsa-miR-1296-3p

Accession MIMAT0026637
Sequence

59 - 

gaguggggcuucgacccuaacc

 - 80

Get sequence
Deep sequencing887 reads, 70 experiments
Evidence experimental; Illumina [4]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
3
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).