Stem-loop sequence hsa-mir-320c-1

Accession MI0003778
Symbol HGNC:MIR320C1
Description Homo sapiens miR-320c-1 stem-loop
Gene family MIPF0000163; mir-320
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-320. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-320 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u        --aaaaugag        uu       c    cag 
 uugcauua          gccuucuc  cccaguu uucc   a
 ||||||||          ||||||||  ||||||| ||||    
 gauguagu          ugggagag  gggucga aagg   g
g        aaaaaaaaga        uu       a    acu 
Get sequence
Deep sequencing
15262 reads, 44 experiments
Comments

This sequence was identified as a candidate by RAKE analysis [1], and later confirmed by Solexa sequencing [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr18: 19263471-19263558 [+]
antisense
OTTHUMT00000444758 ; ABHD3-003; intron 3
OTTHUMT00000444759 ; ABHD3-002; intron 3
OTTHUMT00000445564 ; ABHD3-006; intron 3
OTTHUMT00000445565 ; ABHD3-007; intron 3
OTTHUMT00000444757 ; ABHD3-001; intron 4
OTTHUMT00000444760 ; ABHD3-004; intron 4
ENST00000580981 ; ABHD3-003; intron 3
ENST00000578270 ; ABHD3-002; intron 3
ENST00000579875 ; ABHD3-006; intron 3
ENST00000584464 ; ABHD3-007; intron 3
ENST00000289119 ; ABHD3-201; intron 4
ENST00000289119 ; ABHD3-201; intron 4
ENST00000289119 ; ABHD3-001; intron 4
ENST00000577891 ; ABHD3-004; intron 4
Database links

Mature sequence hsa-miR-320c

Accession MIMAT0005793
Sequence

50 - 

aaaagcuggguugagagggu

 - 69

Get sequence
Deep sequencing 15261 reads, 43 experiments
Evidence experimental; RAKE [1], Solexa [2]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).