Stem-loop sequence hsa-mir-1224

AccessionMI0003764 (change log)
Symbol HGNC:MIR1224
DescriptionHomo sapiens miR-1224 stem-loop
Gene family MIPF0000440; mir-1224
Stem-loop
   g      cuc         a   u  u  cgccggggccgg 
5'  ugagga   gggaggugg ggg gg gc            g
    ||||||   ||||||||| ||| || ||            c
3'  acuccu   uccuccacc ccc cu cg            g
   g      cuc         c   u  u  cucgacuuuguc 
Get sequence
Deep sequencing
3959 reads, 28 reads per million, 50 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by more extensive cloning [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 184241405-184241489 [+]
sense
OTTHUMT00000346333 ; EIF2B5-017; intron 15
ENST00000444495 ; EIF2B5-017; intron 15
Database links

Mature sequence hsa-miR-1224-5p

Accession MIMAT0005458
Sequence

1 - 

gugaggacucgggaggugg

 - 19

Get sequence
Deep sequencing2343 reads, 47 experiments
Evidence experimental; RAKE [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-1224-3p

Accession MIMAT0005459
Sequence

65 - 

ccccaccuccucucuccucag

 - 85

Get sequence
Deep sequencing1590 reads, 15 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).