Stem-loop sequence hsa-mir-767

AccessionMI0003763
Symbol HGNC:MIR767
DescriptionHomo sapiens miR-767 stem-loop
Gene family MIPF0000552; mir-767
Stem-loop
     -uuuu   u  u             u c       uu  c      u    c 
5' gc     aua ug agguuuuugcuca g accaugg  gu ugagca gcag a
   ||     ||| || ||||||||||||| | |||||||  || |||||| |||| u
3' cg     ugu ac uccaaggacgagu u ugguacc  ca acucgu uguu g
     ucauc   u  u             c u       -c  u      c    c 
Get sequence
Deep sequencing
1183 reads, 283 reads per million, 22 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 152393421-152393529 [-]
sense
OTTHUMT00000144474 ; AC151961.1-001; exon 1
ENST00000456193 ; AC151961.1-001; exon 1
Clustered miRNAs
< 10kb from hsa-mir-767
hsa-mir-105-2chrX: 152394412-152394492 [-]
hsa-mir-767chrX: 152393421-152393529 [-]
hsa-mir-105-1chrX: 152392219-152392299 [-]
Database links

Mature sequence hsa-miR-767-5p

Accession MIMAT0003882
Sequence

27 - 

ugcaccaugguugucugagcaug

 - 49

Get sequence
Deep sequencing653 reads, 13 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence hsa-miR-767-3p

Accession MIMAT0003883
Sequence

61 - 

ucugcucauaccccaugguuucu

 - 83

Get sequence
Deep sequencing31 reads, 6 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).