Stem-loop sequence hsa-mir-550a-3

AccessionMI0003762 (change log)
Symbol HGNC:MIR550A3
DescriptionHomo sapiens miR-550a-3 stem-loop
Gene family MIPF0000334; mir-550
Literature search

18 open access papers mention hsa-mir-550a-3
(113 sentences)

Stem-loop
     u    u c   cu   gca                  guc     gu 
5' ga gcuu g ugg  ggu   gugccugagggaguaaga   cuguu  u
   || |||| | |||  |||   ||||||||||||||||||   |||||  g
3' cu ugaa c acc  cua   cacggacucccucauucu   gauag  u
     c    - a   -u   ---                  -gu     aa 
Get sequence
Deep sequencing
8672 reads, 16.9 reads per million, 154 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 29680734-29680828 [-]
sense
OTTHUMT00000327678 ; AC007276.6-002; intron 1
ENST00000442865 ; ZNRF2P2-002; intron 1
Database links

Mature sequence hsa-miR-550a-3-5p

Accession MIMAT0020925
Sequence

21 - 

agugccugagggaguaagag

 - 40

Get sequence
Deep sequencing4156 reads, 139 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-550a-3p

Accession MIMAT0003257
Previous IDshsa-miR-550;hsa-miR-550*;hsa-miR-550a*
Sequence

60 - 

ugucuuacucccucaggcacau

 - 81

Get sequence
Deep sequencing13506 reads, 136 experiments
Evidence experimental; RAKE [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
3
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).