|
miRBase |
|
Stem-loop sequence hsa-mir-671 |
|||||
| Accession | MI0003760 | ||||
| Symbol | HGNC:MIR671 | ||||
| Description | Homo sapiens miR-671 stem-loop | ||||
| Gene family | MIPF0000358; mir-671 | ||||
| Stem-loop |
ggu aa ----a a a a ga -u g gca g cuggc ggcc ggaagagg gga gcccug ggggcuggagg gau g ||| | ||||| |||| |||||||| ||| |||||| ||||||||||| ||| cgu c gaccg ccgg cuuucucc ccu cgggac ucuuggccucc uug a ggu gg agaug g a - -- uu u |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-671-5p |
|
| Accession | MIMAT0003880 |
| Previous IDs | hsa-miR-671 |
| Sequence |
29 - aggaagcccuggaggggcuggag - 51 |
| Deep sequencing | 579 reads, 24 experiments |
| Evidence | experimental; cloned [1-2] |
| Predicted targets |
|
Mature sequence hsa-miR-671-3p |
|
| Accession | MIMAT0004819 |
| Sequence |
68 - uccgguucucagggcuccacc - 88 |
| Deep sequencing | 78 reads, 21 experiments |
| Evidence | experimental; cloned [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|