Stem-loop sequence rlcv-mir-rL1-8

AccessionMI0003744 (change log)
DescriptionRhesus lymphocryptovirus miR-rL1-8 stem-loop
Gene family MIPF0000326; mir-BART5
Stem-loop
    ug     g   c   a       aua  u        aug   g 
5' u  cugcg cac gua ggugaau   gc gcccauug   ucu u
   |  ||||| ||| ||| |||||||   || ||||||||   |||  
3' a  gacgc gug cau ccacuug   cg cggguggc   aga u
    gu     a   a   -       --a  c        cca   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rlcv-miR-rL1-8-5p

Accession MIMAT0003437
Previous IDsrlcv-miR-rL1-8
Sequence

15 - 

uaaggugaauauagcugcccauu

 - 37

Get sequence
Evidence experimental; cloned [1-2], Illumina [3-4]

Mature sequence rlcv-miR-rL1-8-3p

Accession MIMAT0019087
Previous IDsrlcv-mir-rL1-8-3p
Sequence

56 - 

ggugggccgcaguucaccuaca

 - 77

Get sequence
Evidence experimental; Illumina [3]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20219930 "Comprehensive analysis of Rhesus lymphocryptovirus microRNA expression" Riley KJ, Rabinowitz GS, Steitz JA J Virol. 84:5148-5157(2010).
4
PMID:24257599 "Evolutionary conservation of primate lymphocryptovirus microRNA targets" Skalsky RL, Kang D, Linnstaedt SD, Cullen BR J Virol. 88:1617-1635(2014).