Stem-loop sequence rlcv-mir-rL1-6

AccessionMI0003742 (change log)
DescriptionRhesus lymphocryptovirus miR-rL1-6 stem-loop
Gene family MIPF0000325; mir-BART1
Stem-loop
   c          uuu       -    ac        auua 
5'  ccuugguggg   uagugga agug  gugcugug    g
    ||||||||||   ||||||| ||||  ||||||||     
3'  gggaccacuc   aucaccu ucgc  cacgauac    g
   -          ugu       a    --        ccau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rlcv-miR-rL1-6-5p

Accession MIMAT0003434
Sequence

12 - 

uuuuaguggaagugacgugcugu

 - 34

Get sequence
Evidence experimental; cloned [1], Illumina [3-4]

Mature sequence rlcv-miR-rL1-6-3p

Accession MIMAT0003435
Previous IDsrlcv-miR-rL1-6-3p;rlcv-miR-rL1-6
Sequence

48 - 

uagcaccgcuauccacuaugucu

 - 70

Get sequence
Evidence experimental; cloned [1-2], Illumina [3-4]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20219930 "Comprehensive analysis of Rhesus lymphocryptovirus microRNA expression" Riley KJ, Rabinowitz GS, Steitz JA J Virol. 84:5148-5157(2010).
4
PMID:24257599 "Evolutionary conservation of primate lymphocryptovirus microRNA targets" Skalsky RL, Kang D, Linnstaedt SD, Cullen BR J Virol. 88:1617-1635(2014).