Stem-loop sequence rlcv-mir-rL1-2

Accession

MI0003738

Description

Rhesus lymphocryptovirus miR-rL1-2 stem-loop

Gene family

MIPF0000332; mir-BHRF1-2

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-BHRF1-2_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The mir-BHRF1-2 microRNA precursor found in human herpesvirus 4 (Epstein-Barr virus), cercopithicine herpesvirus 15 and herpesvirus papio. In Epstein-Barr virus, mir-BHRF1-2 is found in the 3' UTR of the BHRF1 (Bam HI fragment H rightward open reading frame 1) gene, which is known to encode a distant Bcl-2 homolog. The mature sequence is excised from the 3' arm of the hairpin. Two other miRNA precursors were found in this reading frame, namely Mir-BHRF1-1 and Mir-BHRF1-3. BHRF-1-2 miRNA is though to operate as part of a 'miRNA cluster' with two other microRNAs also found in the Epstein-Barr virus genome. BHRF-1-2 has been shown to be expressed in latency-III infected lymphoblasts.

Stem-loop

   cc     uu       g  a           ugau 
gcc  cacuu  aaauucu cc cagaagauagc    a
|||  |||||  ||||||| || |||||||||||    c
cgg  gugaa  uuuaagg gg guuuucuauug    u
   uu     cc       g  c           uagc 

Mature sequence rlcv-miR-rL1-2-5p

• Accession: MIMAT0019085
• Previous IDs: rlcv-mir-rL1-2-5p
• Sequence: 13 - aaauucugccacagaagauagc - 34
• Evidence: experimental; Solexa [2]

Mature sequence rlcv-miR-rL1-2-3p

• Accession: MIMAT0003428
• Previous IDs: rlcv-miR-rL1-2
• Sequence: 48 - uaucuuuugcgggggaauuucca - 70
• Evidence: experimental; cloned [1], Solexa [2]

References

1. PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2. PMID:20219930 "Comprehensive analysis of Rhesus lymphocryptovirus microRNA expression" Riley KJ, Rabinowitz GS, Steitz JA J Virol. 84:5148-5157(2010).