Stem-loop sequence ebv-mir-BART10

AccessionMI0003732 (change log)
DescriptionEpstein Barr virus miR-BART10 stem-loop
Gene family MIPF0000850; mir-BART10
Stem-loop
       -      uc   g     c    u     c      uauu 
5' caga ggagug  ccg ggcca cucu ugguu uguaca    u
   |||| ||||||  ||| ||||| |||| ||||| ||||||    u
3' gucu ccucac  ggu ucggu gagg accaa acaugu    g
       a      gu   g     u    u     u      uauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

mir-BART10 was discovered independently by two groups. Cai et al mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 3' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence was misnamed miR-BART14 in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 147304-147393 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART10
ebv-mir-BART3HHV507799: 139076-139154 [+]
ebv-mir-BART4HHV507799: 139220-139295 [+]
ebv-mir-BART1HHV507799: 139346-139415 [+]
ebv-mir-BART15HHV507799: 139507-139584 [+]
ebv-mir-BART5HHV507799: 139661-139749 [+]
ebv-mir-BART16HHV507799: 139776-139874 [+]
ebv-mir-BART17HHV507799: 139894-139995 [+]
ebv-mir-BART6HHV507799: 140016-140107 [+]
ebv-mir-BART21HHV507799: 145503-145578 [+]
ebv-mir-BART18HHV507799: 145932-146050 [+]
ebv-mir-BART7HHV507799: 146425-146510 [+]
ebv-mir-BART8HHV507799: 146759-146840 [+]
ebv-mir-BART9HHV507799: 146946-147032 [+]
ebv-mir-BART22HHV507799: 147161-147231 [+]
ebv-mir-BART10HHV507799: 147304-147393 [+]
ebv-mir-BART11HHV507799: 147524-147609 [+]
ebv-mir-BART12HHV507799: 147888-147970 [+]
ebv-mir-BART19HHV507799: 148198-148290 [+]
ebv-mir-BART20HHV507799: 148319-148417 [+]
ebv-mir-BART13HHV507799: 148512-148597 [+]
ebv-mir-BART14HHV507799: 148731-148815 [+]
ebv-mir-BART2HHV507799: 152745-152806 [+]
Database links

Mature sequence ebv-miR-BART10-5p

Accession MIMAT0004817
Previous IDsebv-miR-BART10*
Sequence

18 - 

gccaccucuuugguucuguaca

 - 39

Get sequence
Evidence experimental; cloned [3]

Mature sequence ebv-miR-BART10-3p

Accession MIMAT0003420
Previous IDsebv-miR-BART10
Sequence

53 - 

uacauaaccauggaguuggcugu

 - 75

Get sequence
Evidence experimental; cloned [1,3], array [2], Northern [2]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).