Stem-loop sequence ebv-mir-BART9

AccessionMI0003731 (change log)
DescriptionEpstein Barr virus miR-BART9 stem-loop
Gene family MIPF0000955; mir-BART9
Stem-loop
       --u      ug   u      -    u  gaa    uaac 
5' cagc   guuguu  uac ggaccc ugaa ug   acag    u
   ||||   ||||||  ||| |||||| |||| ||   ||||    u
3' gucg   caacag  aug ccuggg acuu ac   uguc    g
       uau      ug   c      u    c  -aa    uuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

mir-BART9 was discovered independently by two groups. Cai et al mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 3' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence was misnamed miR-BART13 in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 146946-147032 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART9
ebv-mir-BART3HHV507799: 139076-139154 [+]
ebv-mir-BART4HHV507799: 139220-139295 [+]
ebv-mir-BART1HHV507799: 139346-139415 [+]
ebv-mir-BART15HHV507799: 139507-139584 [+]
ebv-mir-BART5HHV507799: 139661-139749 [+]
ebv-mir-BART16HHV507799: 139776-139874 [+]
ebv-mir-BART17HHV507799: 139894-139995 [+]
ebv-mir-BART6HHV507799: 140016-140107 [+]
ebv-mir-BART21HHV507799: 145503-145578 [+]
ebv-mir-BART18HHV507799: 145932-146050 [+]
ebv-mir-BART7HHV507799: 146425-146510 [+]
ebv-mir-BART8HHV507799: 146759-146840 [+]
ebv-mir-BART9HHV507799: 146946-147032 [+]
ebv-mir-BART22HHV507799: 147161-147231 [+]
ebv-mir-BART10HHV507799: 147304-147393 [+]
ebv-mir-BART11HHV507799: 147524-147609 [+]
ebv-mir-BART12HHV507799: 147888-147970 [+]
ebv-mir-BART19HHV507799: 148198-148290 [+]
ebv-mir-BART20HHV507799: 148319-148417 [+]
ebv-mir-BART13HHV507799: 148512-148597 [+]
ebv-mir-BART14HHV507799: 148731-148815 [+]
ebv-mir-BART2HHV507799: 152745-152806 [+]
Database links

Mature sequence ebv-miR-BART9-5p

Accession MIMAT0004816
Previous IDsebv-miR-BART9*
Sequence

14 - 

uacuggacccugaauuggaaac

 - 35

Get sequence
Evidence experimental; cloned [3]

Mature sequence ebv-miR-BART9-3p

Accession MIMAT0003419
Previous IDsebv-miR-BART9
Sequence

52 - 

uaacacuucaugggucccguagu

 - 74

Get sequence
Evidence experimental; cloned [1,3], array [2], Northern [2]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).