Stem-loop sequence ebv-mir-BART8

AccessionMI0003730 (change log)
DescriptionEpstein Barr virus miR-BART8 stem-loop
Stem-loop
        u     a      uu  c        -    auga 
5' ugggu cacug uuacgg  uc uagauugu acag    a
   ||||| ||||| ||||||  || |||||||| ||||    c
3' auucg gugac gaugcu  gg aucuaaca uguc    u
        u     a      gg  u        c    aaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

mir-BART8 was discovered independently by two groups. Cai et al identified a mature miRNA product from the 5' arm of the hairpin precursor and mapped the ends of the mature sequence by cloning [1]. Grundhoff et al report that the 3' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. The ends of ebv-miR-BART8-3p are therefore predicted, not experimentally determined. This sequence was misnamed miR-BART12 in [2]. The mature miRNA names reflect cloning frequencies from Landgraf et al. [3], and may differ subtly from previous annotations. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 146759-146840 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART8
ebv-mir-BART3HHV507799: 139076-139154 [+]
ebv-mir-BART4HHV507799: 139220-139295 [+]
ebv-mir-BART1HHV507799: 139346-139415 [+]
ebv-mir-BART15HHV507799: 139507-139584 [+]
ebv-mir-BART5HHV507799: 139661-139749 [+]
ebv-mir-BART16HHV507799: 139776-139874 [+]
ebv-mir-BART17HHV507799: 139894-139995 [+]
ebv-mir-BART6HHV507799: 140016-140107 [+]
ebv-mir-BART21HHV507799: 145503-145578 [+]
ebv-mir-BART18HHV507799: 145932-146050 [+]
ebv-mir-BART7HHV507799: 146425-146510 [+]
ebv-mir-BART8HHV507799: 146759-146840 [+]
ebv-mir-BART9HHV507799: 146946-147032 [+]
ebv-mir-BART22HHV507799: 147161-147231 [+]
ebv-mir-BART10HHV507799: 147304-147393 [+]
ebv-mir-BART11HHV507799: 147524-147609 [+]
ebv-mir-BART12HHV507799: 147888-147970 [+]
ebv-mir-BART19HHV507799: 148198-148290 [+]
ebv-mir-BART20HHV507799: 148319-148417 [+]
ebv-mir-BART13HHV507799: 148512-148597 [+]
ebv-mir-BART14HHV507799: 148731-148815 [+]
ebv-mir-BART2HHV507799: 152745-152806 [+]
Database links

Mature sequence ebv-miR-BART8-5p

Accession MIMAT0003417
Previous IDsebv-miR-BART8-5p;ebv-miR-BART8
Sequence

14 - 

uacgguuuccuagauuguacag

 - 35

Get sequence
Evidence experimental; cloned [1,3]

Mature sequence ebv-miR-BART8-3p

Accession MIMAT0003418
Previous IDsebv-miR-BART8-3p;ebv-miR-BART8*
Sequence

49 - 

gucacaaucuauggggucguaga

 - 71

Get sequence
Evidence experimental; array [2], Northern [2], cloned [3]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).