Stem-loop sequence ebv-mir-BART8

Accession MI0003730
Description Epstein Barr virus miR-BART8 stem-loop
Stem-loop 
     u     a      uu  c        -    auga 
ugggu cacug uuacgg  uc uagauugu acag    a
||||| ||||| ||||||  || |||||||| ||||    c
auucg gugac gaugcu  gg aucuaaca uguc    u
     u     a      gg  u        c    aaga
Get sequence
Comments

mir-BART8 was discovered independently by two groups. Cai et al identified a mature miRNA product from the 5' arm of the hairpin precursor and mapped the ends of the mature sequence by cloning [1]. Grundhoff et al report that the 3' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. The ends of ebv-miR-BART8-3p are therefore predicted, not experimentally determined. This sequence was misnamed miR-BART12 in [2]. The mature miRNA names reflect cloning frequencies from Landgraf et al. [3], and may differ subtly from previous annotations. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 146759-146840 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART8
ebv-mir-BART3 HHV507799: 139076-139154 [+]
ebv-mir-BART4 HHV507799: 139220-139295 [+]
ebv-mir-BART1 HHV507799: 139346-139415 [+]
ebv-mir-BART15 HHV507799: 139507-139584 [+]
ebv-mir-BART5 HHV507799: 139661-139749 [+]
ebv-mir-BART16 HHV507799: 139776-139874 [+]
ebv-mir-BART17 HHV507799: 139894-139995 [+]
ebv-mir-BART6 HHV507799: 140016-140107 [+]
ebv-mir-BART21 HHV507799: 145503-145578 [+]
ebv-mir-BART18 HHV507799: 145932-146050 [+]
ebv-mir-BART7 HHV507799: 146425-146510 [+]
ebv-mir-BART8 HHV507799: 146759-146840 [+]
ebv-mir-BART9 HHV507799: 146946-147032 [+]
ebv-mir-BART22 HHV507799: 147161-147231 [+]
ebv-mir-BART10 HHV507799: 147304-147393 [+]
ebv-mir-BART11 HHV507799: 147524-147609 [+]
ebv-mir-BART12 HHV507799: 147888-147970 [+]
ebv-mir-BART19 HHV507799: 148198-148290 [+]
ebv-mir-BART20 HHV507799: 148319-148417 [+]
ebv-mir-BART13 HHV507799: 148512-148597 [+]
ebv-mir-BART14 HHV507799: 148731-148815 [+]
ebv-mir-BART2 HHV507799: 152745-152806 [+]

Mature sequence ebv-miR-BART8-5p

Accession MIMAT0003417
Previous IDs ebv-miR-BART8-5p;ebv-miR-BART8
Sequence

14 -  

uacgguuuccuagauuguacag

 - 35

Get sequence
Evidence experimental; cloned [1,3]

Mature sequence ebv-miR-BART8-3p

Accession MIMAT0003418
Previous IDs ebv-miR-BART8-3p;ebv-miR-BART8*
Sequence

49 -  

gucacaaucuauggggucguaga

 - 71

Get sequence
Evidence experimental; array [2], Northern [2], cloned [3]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
PMID:16540699 "A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses" Grundhoff A, Sullivan CS, Ganem D RNA. 12:733-750(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).