Stem-loop sequence ebv-mir-BART7

Accession MI0003729
Description Epstein Barr virus miR-BART7 stem-loop
Gene family MIPF0000328; mir-BART7
Stem-loop 
   -    uc   a        -  u        aa  a  cu 
ucc agug  cug uccuggac cu gacuauga  ca uu  a
||| ||||  ||| |||||||| || ||||||||  || ||   
agg ucac  gac gggaccug ga cugauacu  gu aa  a
   c    gu   a        u  c        ac  a  aa
Get sequence
Comments

mir-BART7 was discovered independently by two groups. Cai et al mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 3' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence is misnamed miR-BART11 in [2].

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 146425-146510 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART7
ebv-mir-BART3 HHV507799: 139076-139154 [+]
ebv-mir-BART4 HHV507799: 139220-139295 [+]
ebv-mir-BART1 HHV507799: 139346-139415 [+]
ebv-mir-BART15 HHV507799: 139507-139584 [+]
ebv-mir-BART5 HHV507799: 139661-139749 [+]
ebv-mir-BART16 HHV507799: 139776-139874 [+]
ebv-mir-BART17 HHV507799: 139894-139995 [+]
ebv-mir-BART6 HHV507799: 140016-140107 [+]
ebv-mir-BART21 HHV507799: 145503-145578 [+]
ebv-mir-BART18 HHV507799: 145932-146050 [+]
ebv-mir-BART7 HHV507799: 146425-146510 [+]
ebv-mir-BART8 HHV507799: 146759-146840 [+]
ebv-mir-BART9 HHV507799: 146946-147032 [+]
ebv-mir-BART22 HHV507799: 147161-147231 [+]
ebv-mir-BART10 HHV507799: 147304-147393 [+]
ebv-mir-BART11 HHV507799: 147524-147609 [+]
ebv-mir-BART12 HHV507799: 147888-147970 [+]
ebv-mir-BART19 HHV507799: 148198-148290 [+]
ebv-mir-BART20 HHV507799: 148319-148417 [+]
ebv-mir-BART13 HHV507799: 148512-148597 [+]
ebv-mir-BART14 HHV507799: 148731-148815 [+]
ebv-mir-BART2 HHV507799: 152745-152806 [+]

Mature sequence ebv-miR-BART7-5p

Accession MIMAT0004815
Previous IDs ebv-miR-BART7*
Sequence

15 -  

ccuggaccuugacuaugaaaca

 - 36

Get sequence
Evidence experimental; cloned [3]

Mature sequence ebv-miR-BART7-3p

Accession MIMAT0003416
Previous IDs ebv-miR-BART7
Sequence

51 -  

caucauaguccaguguccaggg

 - 72

Get sequence
Evidence experimental; cloned [1,3], array [2], Northern [2]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
PMID:16540699 "A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses" Grundhoff A, Sullivan CS, Ganem D RNA. 12:733-750(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).