Stem-loop sequence ebv-mir-BART7

AccessionMI0003729 (change log)
DescriptionEpstein Barr virus miR-BART7 stem-loop
Gene family MIPF0000328; mir-BART7
Stem-loop
      -    uc   a        -  u        aa  a  cu 
5' ucc agug  cug uccuggac cu gacuauga  ca uu  a
   ||| ||||  ||| |||||||| || ||||||||  || ||   
3' agg ucac  gac gggaccug ga cugauacu  gu aa  a
      c    gu   a        u  c        ac  a  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

mir-BART7 was discovered independently by two groups. Cai et al mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 3' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence is misnamed miR-BART11 in [2].

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 146425-146510 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART7
ebv-mir-BART3HHV507799: 139076-139154 [+]
ebv-mir-BART4HHV507799: 139220-139295 [+]
ebv-mir-BART1HHV507799: 139346-139415 [+]
ebv-mir-BART15HHV507799: 139507-139584 [+]
ebv-mir-BART5HHV507799: 139661-139749 [+]
ebv-mir-BART16HHV507799: 139776-139874 [+]
ebv-mir-BART17HHV507799: 139894-139995 [+]
ebv-mir-BART6HHV507799: 140016-140107 [+]
ebv-mir-BART21HHV507799: 145503-145578 [+]
ebv-mir-BART18HHV507799: 145932-146050 [+]
ebv-mir-BART7HHV507799: 146425-146510 [+]
ebv-mir-BART8HHV507799: 146759-146840 [+]
ebv-mir-BART9HHV507799: 146946-147032 [+]
ebv-mir-BART22HHV507799: 147161-147231 [+]
ebv-mir-BART10HHV507799: 147304-147393 [+]
ebv-mir-BART11HHV507799: 147524-147609 [+]
ebv-mir-BART12HHV507799: 147888-147970 [+]
ebv-mir-BART19HHV507799: 148198-148290 [+]
ebv-mir-BART20HHV507799: 148319-148417 [+]
ebv-mir-BART13HHV507799: 148512-148597 [+]
ebv-mir-BART14HHV507799: 148731-148815 [+]
ebv-mir-BART2HHV507799: 152745-152806 [+]
Database links

Mature sequence ebv-miR-BART7-5p

Accession MIMAT0004815
Previous IDsebv-miR-BART7*
Sequence

15 - 

ccuggaccuugacuaugaaaca

 - 36

Get sequence
Evidence experimental; cloned [3]

Mature sequence ebv-miR-BART7-3p

Accession MIMAT0003416
Previous IDsebv-miR-BART7
Sequence

51 - 

caucauaguccaguguccaggg

 - 72

Get sequence
Evidence experimental; cloned [1,3], array [2], Northern [2]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).