Stem-loop sequence ebv-mir-BART5

AccessionMI0003727 (change log)
DescriptionEpstein Barr virus miR-BART5 stem-loop
Gene family MIPF0000326; mir-BART5
Stem-loop
     uc    g   cuca      au     u        ac  a  g 
5' gc  ugug cac    agguga  auagc gcccaucg  gu uc c
   ||  |||| |||    ||||||  ||||| ||||||||  || ||  
3' ug  acgc gug    uccacu  ugucg cggguggc  ca ag u
     ga    a   -aaa      --     c        --  a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

mir-BART5 was discovered independently by two groups. Cai et al mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 5' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence was misnamed miR-BART6 in [2].

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 139661-139749 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART5
ebv-mir-BART3HHV507799: 139076-139154 [+]
ebv-mir-BART4HHV507799: 139220-139295 [+]
ebv-mir-BART1HHV507799: 139346-139415 [+]
ebv-mir-BART15HHV507799: 139507-139584 [+]
ebv-mir-BART5HHV507799: 139661-139749 [+]
ebv-mir-BART16HHV507799: 139776-139874 [+]
ebv-mir-BART17HHV507799: 139894-139995 [+]
ebv-mir-BART6HHV507799: 140016-140107 [+]
ebv-mir-BART21HHV507799: 145503-145578 [+]
ebv-mir-BART18HHV507799: 145932-146050 [+]
ebv-mir-BART7HHV507799: 146425-146510 [+]
ebv-mir-BART8HHV507799: 146759-146840 [+]
ebv-mir-BART9HHV507799: 146946-147032 [+]
ebv-mir-BART22HHV507799: 147161-147231 [+]
ebv-mir-BART10HHV507799: 147304-147393 [+]
ebv-mir-BART11HHV507799: 147524-147609 [+]
ebv-mir-BART12HHV507799: 147888-147970 [+]
ebv-mir-BART19HHV507799: 148198-148290 [+]
ebv-mir-BART20HHV507799: 148319-148417 [+]
ebv-mir-BART13HHV507799: 148512-148597 [+]
ebv-mir-BART14HHV507799: 148731-148815 [+]
Database links

Mature sequence ebv-miR-BART5-5p

Accession MIMAT0003413
Previous IDsebv-miR-BART5
Sequence

15 - 

caaggugaauauagcugcccaucg

 - 38

Get sequence
Evidence experimental; cloned [1,3], array [2], Northern [2]

Mature sequence ebv-miR-BART5-3p

Accession MIMAT0009205
Previous IDsebv-miR-BART5*
Sequence

57 - 

gugggccgcuguucaccu

 - 74

Get sequence
Evidence experimental; 454 [4]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).