Stem-loop sequence ebv-mir-BART4

AccessionMI0003726 (change log)
DescriptionEpstein Barr virus miR-BART4 stem-loop
Gene family MIPF0000324; mir-BART3
Stem-loop
   u       g     a   -   -         --   aa 
5'  uuggugg accug ugc ugc uggugugcu  gua  u
    ||||||| ||||| ||| ||| |||||||||  |||   
3'  gaccacu uggac acg aug acuacacga  cgu  a
   g       g     c   g   c         uc   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

mir-BART4 was discovered independently by two groups. Cai et al. mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 5' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2].

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 139220-139295 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART4
ebv-mir-BART3HHV507799: 139076-139154 [+]
ebv-mir-BART4HHV507799: 139220-139295 [+]
ebv-mir-BART1HHV507799: 139346-139415 [+]
ebv-mir-BART15HHV507799: 139507-139584 [+]
ebv-mir-BART5HHV507799: 139661-139749 [+]
ebv-mir-BART16HHV507799: 139776-139874 [+]
ebv-mir-BART17HHV507799: 139894-139995 [+]
ebv-mir-BART6HHV507799: 140016-140107 [+]
ebv-mir-BART21HHV507799: 145503-145578 [+]
ebv-mir-BART18HHV507799: 145932-146050 [+]
ebv-mir-BART7HHV507799: 146425-146510 [+]
ebv-mir-BART8HHV507799: 146759-146840 [+]
ebv-mir-BART9HHV507799: 146946-147032 [+]
ebv-mir-BART22HHV507799: 147161-147231 [+]
ebv-mir-BART10HHV507799: 147304-147393 [+]
ebv-mir-BART11HHV507799: 147524-147609 [+]
ebv-mir-BART12HHV507799: 147888-147970 [+]
ebv-mir-BART19HHV507799: 148198-148290 [+]
ebv-mir-BART20HHV507799: 148319-148417 [+]
ebv-mir-BART13HHV507799: 148512-148597 [+]
ebv-mir-BART14HHV507799: 148731-148815 [+]
Database links

Mature sequence ebv-miR-BART4-5p

Accession MIMAT0003412
Previous IDsebv-miR-BART4
Sequence

9 - 

gaccugaugcugcuggugugcu

 - 30

Get sequence
Evidence experimental; cloned [1,3], array [2], Northern [2]

Mature sequence ebv-miR-BART4-3p

Accession MIMAT0009204
Previous IDsebv-miR-BART4*
Sequence

47 - 

cacaucacguaggcaccaggugu

 - 69

Get sequence
Evidence experimental; 454 [4]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).