Stem-loop sequence ebv-mir-BART3

AccessionMI0003725 (change log)
DescriptionEpstein Barr virus miR-BART3 stem-loop
Gene family MIPF0000324; mir-BART3
Stem-loop
            ga    a   -      u       uaaau 
5' ccuuuggug  accu gug uuagug ugugcug     a
   |||||||||  |||| ||| |||||| |||||||      
3' ggaggccac  ugga cac gaucac acgcgac     a
            ug    c   u      c       cugug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

mir-BART3 was discovered independently by two groups. Cai et al identified mature miRNA products from both arms of the hairpin precursor and mapped the ends of the mature sequences by cloning [1]. Grundhoff et al confirmed that the 5' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. The mature miRNA names reflect cloning frequencies from Landgraf et al. [3], and may differ subtly from previous annotations. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 139076-139154 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART3
ebv-mir-BART3HHV507799: 139076-139154 [+]
ebv-mir-BART4HHV507799: 139220-139295 [+]
ebv-mir-BART1HHV507799: 139346-139415 [+]
ebv-mir-BART15HHV507799: 139507-139584 [+]
ebv-mir-BART5HHV507799: 139661-139749 [+]
ebv-mir-BART16HHV507799: 139776-139874 [+]
ebv-mir-BART17HHV507799: 139894-139995 [+]
ebv-mir-BART6HHV507799: 140016-140107 [+]
ebv-mir-BART21HHV507799: 145503-145578 [+]
ebv-mir-BART18HHV507799: 145932-146050 [+]
ebv-mir-BART7HHV507799: 146425-146510 [+]
ebv-mir-BART8HHV507799: 146759-146840 [+]
ebv-mir-BART9HHV507799: 146946-147032 [+]
ebv-mir-BART22HHV507799: 147161-147231 [+]
ebv-mir-BART10HHV507799: 147304-147393 [+]
ebv-mir-BART11HHV507799: 147524-147609 [+]
ebv-mir-BART12HHV507799: 147888-147970 [+]
ebv-mir-BART19HHV507799: 148198-148290 [+]
ebv-mir-BART20HHV507799: 148319-148417 [+]
ebv-mir-BART13HHV507799: 148512-148597 [+]
ebv-mir-BART14HHV507799: 148731-148815 [+]
Database links

Mature sequence ebv-miR-BART3-5p

Accession MIMAT0003410
Previous IDsebv-miR-BART3-5p;ebv-miR-BART3*
Sequence

12 - 

accuaguguuaguguugugcu

 - 32

Get sequence
Evidence experimental; cloned [1,3], array [2], Northern [2]

Mature sequence ebv-miR-BART3-3p

Accession MIMAT0003411
Previous IDsebv-miR-BART3-3p;ebv-miR-BART3
Sequence

49 - 

cgcaccacuagucaccaggugu

 - 70

Get sequence
Evidence experimental; cloned [1,3]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).