Stem-loop sequence rno-mir-664-2

AccessionMI0003723 (change log)
DescriptionRattus norvegicus miR-664-2 stem-loop
Gene family MIPF0000300; mir-664
Literature search

7 open access papers mention rno-mir-664-2
(17 sentences)

Stem-loop
   cu         aaa   u         aa 
5'   ggcugggga   uga uggauagaa  c
     |||||||||   ||| |||||||||  a
3'   ccgaccccu   auu acuuaucuu  u
   au         --c   u         au 
Get sequence
Deep sequencing
47066 reads, 12.3 reads per million, 479 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 103192581-103192639 [+]
sense
ENSRNOT00000003216 ; Rab3gap2-201; intron 10
ENSRNOT00000034888 ; Rab3gap2-202; intron 10
Database links

Mature sequence rno-miR-664-2-5p

Accession MIMAT0017229
Previous IDsrno-miR-664-2*
Sequence

1 - 

cuggcuggggaaaaugauugg

 - 21

Get sequence
Deep sequencing8417 reads, 422 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-664-3p

Accession MIMAT0003382
Previous IDsrno-miR-664
Sequence

38 - 

uauucauuuacuccccagccua

 - 59

Get sequence
Deep sequencing77272 reads, 473 experiments
Evidence experimental; cloned [1], Northern [1], SOLiD [2]
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).