Stem-loop sequence rno-mir-499

AccessionMI0003721 (change log)
DescriptionRattus norvegicus miR-499 stem-loop
Gene family MIPF0000173; mir-499
Literature search

44 open access papers mention rno-mir-499
(521 sentences)

Stem-loop
     u  ua        a          g uccu 
5' gc gu  agacuugc gugauguuua c    c
   || ||  |||||||| |||||||||| |     
3' cg cg  ucugaacg cacuacaagu g    u
     u  ug        a          - uacc 
Get sequence
Deep sequencing
135815 reads, 70 reads per million, 470 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 151138862-151138926 [+]
sense
ENSRNOT00000025859 ; Myh7b-201; intron 18
Database links

Mature sequence rno-miR-499-5p

Accession MIMAT0003381
Previous IDsrno-miR-499
Sequence

5 - 

uuaagacuugcagugauguuu

 - 25

Get sequence
Deep sequencing134165 reads, 467 experiments
Evidence experimental; cloned [1], Northern [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-499-3p

Accession MIMAT0017227
Previous IDsrno-miR-499*
Sequence

42 - 

aacaucacagcaagucugugcu

 - 63

Get sequence
Deep sequencing1650 reads, 210 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).