Stem-loop sequence rno-mir-505

AccessionMI0003720 (change log)
DescriptionRattus norvegicus miR-505 stem-loop
Gene family MIPF0000217; mir-505
Literature search

4 open access papers mention rno-mir-505
(9 sentences)

Stem-loop
     u           g    a        -u  g 
5' ag gggggagccag aagu uugauguu  cu c
   || ||||||||||| |||| ||||||||  ||  
3' uc cuccuuugguc uuca aacugcga  gg c
     u           g    c        uu  a 
Get sequence
Deep sequencing
31473 reads, 0.204 reads per million, 490 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 143517014-143517080 [-]
antisense
ENSRNOT00000054392 ; Mir3589-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-505
rno-mir-505chrX: 143517014-143517080 [-]
rno-mir-3589chrX: 143516992-143517103 [+]
Database links

Mature sequence rno-miR-505-5p

Accession MIMAT0017226
Previous IDsrno-miR-505*
Sequence

6 - 

gggagccaggaaguauugauguu

 - 28

Get sequence
Deep sequencing735 reads, 236 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-505-3p

Accession MIMAT0003380
Previous IDsrno-miR-505
Sequence

43 - 

gucaacacuugcugguuucc

 - 62

Get sequence
Deep sequencing30736 reads, 490 experiments
Evidence experimental; cloned [1], Northern [1], SOLiD [2]
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).