Stem-loop sequence mmu-mir-302d

AccessionMI0003718 (change log)
Symbol MGI:Mir302d
DescriptionMus musculus miR-302d stem-loop
Gene family MIPF0000071; mir-302
Literature search

76 open access papers mention mmu-mir-302d
(523 sentences)

Stem-loop
     uu     u                cug gca 
5' cc  uacuu aacauggaggcacuug   u   u
   ||  ||||| ||||||||||||||||   |    
3' gg  gugag uuguaccuucgugaau   a   u
     -u     u                -aa aau 
Get sequence
Deep sequencing
4374 reads, 50 reads per million, 22 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse miR-302d was verified experimentally by Mineno et al using MPSS technology [1]. The MPSS protocol used provides 22nt sequences, but the true extents of the mature miRNA are not reliably obtained. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 127545624-127545689 [+]
antisense
ENSMUST00000029588 ; Larp7-201; intron 8
Clustered miRNAs
< 10kb from mmu-mir-302d
mmu-mir-302bchr3: 127545228-127545301 [+]
mmu-mir-302cchr3: 127545363-127545430 [+]
mmu-mir-302achr3: 127545496-127545564 [+]
mmu-mir-302dchr3: 127545624-127545689 [+]
mmu-mir-367chr3: 127545733-127545807 [+]
Database links

Mature sequence mmu-miR-302d-5p

Accession MIMAT0017225
Previous IDsmmu-miR-302d*
Sequence

6 - 

acuuuaacauggaggcacuugcu

 - 28

Get sequence
Deep sequencing35 reads, 6 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-302d-3p

Accession MIMAT0003377
Previous IDsmmu-miR-302d
Sequence

42 - 

uaagugcuuccauguuugagugu

 - 64

Get sequence
Deep sequencing4337 reads, 20 experiments
Evidence experimental; MPSS [1], cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).