Stem-loop sequence mmu-mir-302c

AccessionMI0003717 (change log)
Symbol MGI:Mir302c
DescriptionMus musculus miR-302c stem-loop
Gene family MIPF0000071; mir-302
Literature search

78 open access papers mention mmu-mir-302c
(470 sentences)

Stem-loop
       ug  uu         u   c    -g  u 
5' ccuc  cu  aacaugggg uac ugcu  ug u
   ||||  ||  ||||||||| ||| ||||  || a
3' gggg  ga  uuguaccuu gug acga  ac a
       gu  cu         c   a    aa  a 
Get sequence
Deep sequencing
3020 reads, 44.4 reads per million, 18 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [1]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 127545363-127545430 [+]
antisense
ENSMUST00000029588 ; Larp7-201; intron 8
Clustered miRNAs
< 10kb from mmu-mir-302c
mmu-mir-302bchr3: 127545228-127545301 [+]
mmu-mir-302cchr3: 127545363-127545430 [+]
mmu-mir-302achr3: 127545496-127545564 [+]
mmu-mir-302dchr3: 127545624-127545689 [+]
mmu-mir-367chr3: 127545733-127545807 [+]
Database links

Mature sequence mmu-miR-302c-5p

Accession MIMAT0003375
Previous IDsmmu-miR-302c*
Sequence

6 - 

gcuuuaacaugggguuaccugc

 - 27

Get sequence
Deep sequencing26 reads, 9 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-302c-3p

Accession MIMAT0003376
Previous IDsmmu-miR-302c
Sequence

44 - 

aagugcuuccauguuucagugg

 - 65

Get sequence
Deep sequencing2993 reads, 21 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).