Stem-loop sequence mmu-mir-302b

AccessionMI0003716 (change log)
Symbol MGI:Mir302b
DescriptionMus musculus miR-302b stem-loop
Gene family MIPF0000071; mir-302
Literature search

81 open access papers mention mmu-mir-302b
(624 sentences)

Stem-loop
   guucc    a   uu         au    ucugu   au 
5'      cuuc acu  aacauggga  gcuu     cuc  c
        |||| |||  |||||||||  ||||     |||   
3'      gaag uga  uuguaccuu  ugaa     gag  g
   ----u    a   uu         cg    ----u   aa 
Get sequence
Deep sequencing
4441 reads, 56 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Mouse miR-302b was verified experimentally by Mineno et al using MPSS technology [1]. The MPSS protocol used provides 22nt sequences, but the true extents of the mature miRNA are not reliably obtained. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 127545228-127545301 [+]
antisense
ENSMUST00000029588 ; Larp7-201; intron 8
Clustered miRNAs
< 10kb from mmu-mir-302b
mmu-mir-302bchr3: 127545228-127545301 [+]
mmu-mir-302cchr3: 127545363-127545430 [+]
mmu-mir-302achr3: 127545496-127545564 [+]
mmu-mir-302dchr3: 127545624-127545689 [+]
mmu-mir-367chr3: 127545733-127545807 [+]
Database links

Mature sequence mmu-miR-302b-5p

Accession MIMAT0003373
Previous IDsmmu-miR-302b*
Sequence

11 - 

acuuuaacaugggaaugcuuucu

 - 33

Get sequence
Deep sequencing10 reads, 7 experiments
Evidence experimental; Illumina [3-4]
Predicted targets

Mature sequence mmu-miR-302b-3p

Accession MIMAT0003374
Previous IDsmmu-miR-302b
Sequence

48 - 

uaagugcuuccauguuuuaguag

 - 70

Get sequence
Deep sequencing4431 reads, 23 experiments
Evidence experimental; MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).