Stem-loop sequence gga-mir-449a

AccessionMI0003715 (change log)
Previous IDsgga-mir-449
DescriptionGallus gallus miR-449 stem-loop
Gene family MIPF0000133; mir-449
Literature search

5 open access papers mention gga-mir-449a
(8 sentences)

Stem-loop
   c      c  ug  g      -  ua         --  ug a 
5'  ugugug gg  gg uggcag ug  uguuagcug  gu  a a
    |||||| ||  || |||||| ||  |||||||||  ||  | c
3'  auacac uc  cc aucguu ac  acaaucgac  ca  u u
   c      c  gu  a      g  gc         ua  gu c 
Get sequence
Deep sequencing
90 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 16702946-16703031 [-]
sense
ENSGALT00000043537 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from gga-mir-449a
gga-mir-449cchrZ: 16704099-16704170 [-]
gga-mir-449bchrZ: 16703096-16703189 [-]
gga-mir-449achrZ: 16702946-16703031 [-]
gga-mir-449dchrZ: 16702080-16702162 [-]
Database links

Mature sequence gga-miR-449a

Accession MIMAT0003372
Previous IDsgga-miR-449
Sequence

16 - 

uggcaguguauguuagcuggu

 - 36

Get sequence
Deep sequencing86 reads, 3 experiments
Evidence by similarity; MI0001650
Predicted targets