Stem-loop sequence gga-mir-429

AccessionMI0003714 (change log)
DescriptionGallus gallus miR-429 stem-loop
Gene family MIPF0000019; mir-8
Literature search

8 open access papers mention gga-mir-429
(16 sentences)

Stem-loop
   g  -   u     - u  c          aa       cu  cu 
5'  cc ugc gauug c gu uuaccaggca  guuagau  ag  a
    || ||| ||||| | || ||||||||||  |||||||  ||   
3'  gg acg cuaac g cg aauggucugu  uaaucug  uc  u
   -  u   -     u c  u          ca       --  uu 
Get sequence
Deep sequencing
30948 reads, 360 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr21: 2589432-2589515 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-429
gga-mir-200bchr21: 2594262-2594346 [-]
gga-mir-200achr21: 2591937-2592023 [-]
gga-mir-429chr21: 2589432-2589515 [-]
Database links

Mature sequence gga-miR-429-5p

Accession MIMAT0026635
Sequence

14 - 

ugucuuaccaggcaaaguuaga

 - 35

Get sequence
Deep sequencing134 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence gga-miR-429-3p

Accession MIMAT0003371
Sequence

52 - 

uaauacugucugguaaugccgu

 - 73

Get sequence
Deep sequencing30814 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).