Stem-loop sequence gga-mir-466

AccessionMI0003713 (change log)
DescriptionGallus gallus miR-466 stem-loop
Gene family MIPF0000208; mir-466
Literature search

2 open access papers mention gga-mir-466
(2 sentences)

Stem-loop
   a     c  a    aca                u 
5'  guuuu ug gugu   uauauguauguaugua a
    ||||| || ||||   ||||||||||||||||  
3'  cagaa ac caca   auauauauauauauau u
   -     u  a    cac                a 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 21752898-21752966 [+]
sense
ENSGALT00000014705 ; GTPBP10-201; intron 6
Database links

Mature sequence gga-miR-466

Accession MIMAT0003370
Sequence

47 - 

auauauacacacacacauaagac

 - 69

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence by similarity; MI0002401
Predicted targets