Stem-loop sequence gga-mir-211

AccessionMI0003711 (change log)
DescriptionGallus gallus miR-211 stem-loop
Gene family MIPF0000042; mir-204
Literature search

4 open access papers mention gga-mir-211
(10 sentences)

Stem-loop
         a         ug  a     u    --ga    
5' ccugug gcuucccuu  uc uccua gccu    gcg 
   |||||| |||||||||  || ||||| ||||    || a
3' gggcac cggagggaa  gg agggu cgga    cgu 
         c         gu  c     -    gguc    
Get sequence
Deep sequencing
793 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr28: 2246985-2247058 [+]
intergenic
Database links

Mature sequence gga-miR-211

Accession MIMAT0003368
Sequence

10 - 

uucccuuugucauccuaugccu

 - 31

Get sequence
Deep sequencing780 reads, 5 experiments
Evidence by similarity; MI0000708
Predicted targets