Stem-loop sequence gga-mir-490

AccessionMI0003709 (change log)
DescriptionGallus gallus miR-490 stem-loop
Gene family MIPF0000229; mir-490
Literature search

2 open access papers mention gga-mir-490
(4 sentences)

Stem-loop
   aa  uc           c      --         g   caag   a 
5'   gu  augguucgaca caugga  ucuccaggu ggu    auu u
     ||  ||||||||||| ||||||  ||||||||| |||    ||| a
3'   ca  ugucgaguugu guaccu  ggaggucca cca    uag g
   aa  cu           c      ca         a   --ca   a 
Get sequence
Deep sequencing
4286 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 57923979-57924071 [-]
intergenic
Database links

Mature sequence gga-miR-490-5p

Accession MIMAT0026633
Sequence

18 - 

ccauggaucuccaggugggu

 - 37

Get sequence
Deep sequencing1033 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-490-3p

Accession MIMAT0003366
Sequence

57 - 

caaccuggaggacuccaugcug

 - 78

Get sequence
Deep sequencing3253 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).