Stem-loop sequence gga-mir-489

AccessionMI0003708 (change log)
DescriptionGallus gallus miR-489 stem-loop
Gene family MIPF0000111; mir-489
Literature search

2 open access papers mention gga-mir-489
(3 sentences)

Stem-loop
    ug ug c    ug             c      ua     a 
5' g  g  g uugg  gucguauguauga gucauu  cuugg c
   |  |  | ||||  ||||||||||||| ||||||  |||||  
3' c  c  c aauc  cggcauguauacu caguga  ggauu u
    gu gu a    gu             a      --     u 
Get sequence
Deep sequencing
3077 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 23147300-23147383 [-]
sense
ENSGALT00000035265 ; gga-mir-489-201; exon 1
Database links

Mature sequence gga-miR-489-5p

Accession MIMAT0026632
Sequence

13 - 

uggucguauguaugacgucauu

 - 34

Get sequence
Deep sequencing116 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-489-3p

Accession MIMAT0003365
Sequence

51 - 

agugacaucauauguacggcugc

 - 73

Get sequence
Deep sequencing2952 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).