Stem-loop sequence gga-mir-455

AccessionMI0003707 (change log)
DescriptionGallus gallus miR-455 stem-loop
Gene family MIPF0000129; mir-455
Literature search

4 open access papers mention gga-mir-455
(4 sentences)

Stem-loop
   u  c   u ug  g          u      a   c   gaa 
5'  cc ugg g  ag guaugugccc uggacu cau gug   g
    || ||| |  || |||||||||| |||||| ||| |||    
3'  gg acu c  uc cauauacggg accuga gua cac   c
   u  a   c gu  a          u      c   c   gac 
Get sequence
Deep sequencing
4286 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr17: 5239491-5239576 [+]
sense
Database links

Mature sequence gga-miR-455-5p

Accession MIMAT0003364
Previous IDsgga-miR-455
Sequence

16 - 

uaugugcccuuggacuacaucg

 - 37

Get sequence
Deep sequencing2630 reads, 5 experiments
Evidence by similarity; MI0003513
Database links
Predicted targets

Mature sequence gga-miR-455-3p

Accession MIMAT0006788
Sequence

53 - 

ugcaguccaugggcauauacac

 - 74

Get sequence
Deep sequencing1656 reads, 5 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).