Stem-loop sequence gga-mir-383

AccessionMI0003706 (change log)
DescriptionGallus gallus miR-383 stem-loop
Gene family MIPF0000137; mir-383
Literature search

5 open access papers mention gga-mir-383
(26 sentences)

Stem-loop
      -c  a      aa    a        -  g   a 
5' cuc  uc gaucag  ggug uuguggcu uu ggu a
   |||  || ||||||  |||| |||||||| || |||  
3' gag  ag cugguc  ucac gacaccga ga uua a
      aa  a      cg    -        c  g   u 
Get sequence
Deep sequencing
30195 reads, 180 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 64399452-64399524 [+]
sense
ENSGALT00000022249 ; SGCZ-201; intron 2
AADN04015343.1: 4580-4652 [+]
sense
ENSGALT00000022249 ; SGCZ-201; intron 2
Database links

Mature sequence gga-miR-383-5p

Accession MIMAT0003363
Sequence

7 - 

agaucagaaggugauuguggcu

 - 28

Get sequence
Deep sequencing29863 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence gga-miR-383-3p

Accession MIMAT0026631
Sequence

48 - 

ccacagcacugccuggucaga

 - 68

Get sequence
Deep sequencing307 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).