Stem-loop sequence gga-mir-365-2

AccessionMI0003704 (change log)
DescriptionGallus gallus miR-365-2 stem-loop
Gene family MIPF0000061; mir-365
Literature search

4 open access papers mention gga-mir-365-2
(20 sentences)

Stem-loop
   --   ---a       a        ac   c       -----    u   u 
5'   ggc    gcaagaa aaugaggg  uuu aggggca     gcug guu u
     |||    ||||||| ||||||||  ||| |||||||     |||| ||| a
3'   cug    cguucuu uuauuccu  aaa uccccgu     ugac caa c
   aa   guaa       g        aa   -       aauac    c   u 
Get sequence
Deep sequencing
985 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr18: 6504853-6504948 [+]
intergenic
Database links

Mature sequence gga-miR-365-2-5p

Accession MIMAT0031075
Sequence

16 - 

gagggacuuucaggggcagcugu

 - 38

Get sequence
Deep sequencing217 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-365-3p

Accession MIMAT0003361
Sequence

57 - 

uaaugccccuaaaaauccuuau

 - 78

Get sequence
Deep sequencing1534 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).