Stem-loop sequence gga-mir-302c

AccessionMI0003701 (change log)
DescriptionGallus gallus miR-302c stem-loop
Gene family MIPF0000071; mir-302
Literature search

5 open access papers mention gga-mir-302c
(12 sentences)

Stem-loop
     u     uu             c    gcc 
5' cc ccgcu  aacauggagguac ugcu   u
   || |||||  ||||||||||||| ||||   a
3' gg gguga  uuguaccuucgug auga   c
     u     cu             a    aaa 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 57456541-57456605 [+]
antisense
ENSGALT00000019679 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from gga-mir-302c
gga-mir-302bchr4: 57456279-57456350 [+]
gga-mir-302cchr4: 57456541-57456605 [+]
gga-mir-1811chr4: 57456663-57456743 [+]
gga-mir-302achr4: 57456844-57456910 [+]
gga-mir-302dchr4: 57457179-57457247 [+]
gga-mir-367chr4: 57457315-57457387 [+]
Database links

Mature sequence gga-miR-302c-5p

Accession MIMAT0003358
Previous IDsgga-miR-302c*
Sequence

8 - 

uuuaacauggagguaccugcug

 - 29

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0000773
Predicted targets

Mature sequence gga-miR-302c-3p

Accession MIMAT0003359
Previous IDsgga-miR-302c
Sequence

40 - 

uaagugcuuccauguuucagugg

 - 62

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence by similarity; MI0000773
Predicted targets