Stem-loop sequence gga-mir-147

AccessionMI0003696 (change log)
Previous IDsgga-mir-147-1
DescriptionGallus gallus miR-147 stem-loop
Gene family MIPF0000105; mir-147
Literature search

4 open access papers mention gga-mir-147
(10 sentences)

Stem-loop
   aauc   ug   u  c        aaacuugacu    a 
5'     uag  gaa ca uucugcac          acug a
       |||  ||| || ||||||||          ||||  
3'     auc  cuu gu aaggcgug          ugac a
   uuac   gu   c  a        ----------    u 
Get sequence
Deep sequencing
349 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 10668517-10668586 [+]
sense
ENSGALT00000045297 ; gga-mir-147-201; exon 4
Database links

Mature sequence gga-miR-147

Accession MIMAT0003352
Sequence

45 - 

gugugcggaaaugcuucugc

 - 64

Get sequence
Deep sequencing320 reads, 4 experiments
Evidence by similarity; MI0000262
Predicted targets